View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0084_high_1 (Length: 358)
Name: NF0084_high_1
Description: NF0084
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0084_high_1 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 30 - 304
Target Start/End: Original strand, 2989422 - 2989695
Alignment:
| Q |
30 |
ggaatcctgtcgcaggagtgatgggaccggcctatggtacatatatgaatatttatgatatgaatattatcatatagtggtgccatcctcctgcgacatg |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2989422 |
ggaatcctgtcgcaggagtgatgggaccggcctatggtacatatatgaatatttatgatatgaatattatcatatagtggtgccatcctcctgcgacatg |
2989521 |
T |
|
| Q |
130 |
attcccttcaacctctagctgacaactcaattttgatgttttttctctctctttatattagaaactttcaatcaatcaggttatagaacgggttagtttg |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
2989522 |
attcccttcaacctctagctgacaactcaattttgatgttttttctctctctttatgttagaaactttcaatcaa-caggttatagaacgggttagtttg |
2989620 |
T |
|
| Q |
230 |
taagttcagtcttttgtttgtactatagttttgtcgaactggattgaagaagttgagttgtgatcggtttaccta |
304 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2989621 |
taagttcagttttttgtttgtactatagttttgtcgaactggattgaagaagttgagttgtgatcggtttaccta |
2989695 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 918 times since January 2019
Visitors: 1288