View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0084_high_4 (Length: 201)
Name: NF0084_high_4
Description: NF0084
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0084_high_4 |
 | |
|
| [»] scaffold0042 (1 HSPs) |
| | |
|
Alignment Details
Target: chr2 (Bit Score: 119; Significance: 5e-61; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 119; E-Value: 5e-61
Query Start/End: Original strand, 20 - 177
Target Start/End: Original strand, 44741950 - 44742107
Alignment:
| Q |
20 |
atgtcaatgaaaatgtaatgttggaagtaaatttaaaaaccccaaagggtatggttctttttaacccggaagggctgtttggttactaacgtgtgttgga |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
44741950 |
atgtcaatgaaaatgtaatgttggaagtaaatttaaaaaccccaaagggtatggttc-ttttaacccgtaagggctgtttggttactaacgtgtgttgga |
44742048 |
T |
|
| Q |
120 |
-tcatcccttgatcagaattcaagcgcgtttggaaccgtttgtgttggtggtctgtgct |
177 |
Q |
| |
|
||||||||||||| | ||||||||||| ||||||||||||||||||||||| ||||| |
|
|
| T |
44742049 |
ctcatcccttgatctgggttcaagcgcgtctggaaccgtttgtgttggtggtccgtgct |
44742107 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 47; Significance: 5e-18; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 56 - 177
Target Start/End: Complemental strand, 26373673 - 26373552
Alignment:
| Q |
56 |
aaaccccaaagggtatggttctttttaacccggaagggctgtttggttactaacgtgtgttgga-tcatcccttgatcagaattcaagcgcgtttggaac |
154 |
Q |
| |
|
|||||| ||||||||||||||||| |||||| ||||||||||||||||||||||||||||||| ||||||| | ||| | |||| | ||| || ||| |
|
|
| T |
26373673 |
aaacccgaaagggtatggttcttta-aacccgtaagggctgtttggttactaacgtgtgttggactcatcccataatctgggttcagacacgtctgaaac |
26373575 |
T |
|
| Q |
155 |
cgtttgtgttggtggtctgtgct |
177 |
Q |
| |
|
| |||||||||||||||||||| |
|
|
| T |
26373574 |
tggttgtgttggtggtctgtgct |
26373552 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0042 (Bit Score: 35; Significance: 0.00000000007; HSPs: 1)
Name: scaffold0042
Description:
Target: scaffold0042; HSP #1
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 56 - 177
Target Start/End: Original strand, 30934 - 31055
Alignment:
| Q |
56 |
aaaccccaaagggtatggttctttttaacccggaagggctgtttggttactaacgtgtgttgga-tcatcccttgatcagaattcaagcgcgtttggaac |
154 |
Q |
| |
|
|||||| ||||||||||||||||| |||| ||||| |||||||||||||||||||||| || ||||||| ||||| || |||| | ||| || ||| |
|
|
| T |
30934 |
aaacccgaaagggtatggttcttta-aacctataagggttgtttggttactaacgtgtgttagactcatcccatgatctgagttcagacacgtctgaaac |
31032 |
T |
|
| Q |
155 |
cgtttgtgttggtggtctgtgct |
177 |
Q |
| |
|
| ||||||||||||| |||||| |
|
|
| T |
31033 |
tggttgtgttggtggtttgtgct |
31055 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1055 times since January 2019
Visitors: 1289