View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0084_low_3 (Length: 305)
Name: NF0084_low_3
Description: NF0084
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0084_low_3 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 7 - 207
Target Start/End: Complemental strand, 4997426 - 4997226
Alignment:
| Q |
7 |
gaaactggcctaaactcgccggaatgtcacctgtgaaaaggttattagacaaattgagcacattcagttttggtaatcggccaaaactcgctggaatgtc |
106 |
Q |
| |
|
||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4997426 |
gaaactggcctaaactcactggaatgtcacctgtgaaaaggttattagacaaattgagcacattcagttttggtaatcggccaaaactcgctggaatgtc |
4997327 |
T |
 |
| Q |
107 |
accggagaagttgtttcctgtggcgtcaagtactcttagttcaaagatttctgagttgaaatctggtaaggctccgacgaataagttgtcggagatgttc |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
4997326 |
accggagaagttgtttcctgtggcgtcaagtactcttagttcaaagatttctgagttgaaatctggtaaggctccaacgaataagttgtcggagatgttc |
4997227 |
T |
 |
| Q |
207 |
a |
207 |
Q |
| |
|
| |
|
|
| T |
4997226 |
a |
4997226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 84; Significance: 6e-40; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 84; E-Value: 6e-40
Query Start/End: Original strand, 200 - 295
Target Start/End: Original strand, 52446016 - 52446111
Alignment:
| Q |
200 |
gatgttcattattttattattggtgtttatttacatctttctattgtttcaatttatggatgattcacaatttcaatcgcaatgtacgtgtctctg |
295 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||| |
|
|
| T |
52446016 |
gatgttcattattttattattggcgtttatttacatctttctattgtttcaatttatggatgattcacaatttcaatcacaatgtatgtgtctctg |
52446111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 200 - 276
Target Start/End: Original strand, 52446956 - 52447031
Alignment:
| Q |
200 |
gatgttcattattttattattggtgtttatttacatctttctattgtttcaatttatggatgattcacaatttcaat |
276 |
Q |
| |
|
|||||||||| || ||||||||||||||||||||| ||| |||||||| |||||| |||||||| ||||||||||| |
|
|
| T |
52446956 |
gatgttcattgttctattattggtgtttatttacacgtttttattgttttaatttagggatgatt-acaatttcaat |
52447031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University