View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0084_low_4 (Length: 287)
Name: NF0084_low_4
Description: NF0084
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0084_low_4 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 67; Significance: 8e-30; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 154 - 241
Target Start/End: Original strand, 1807604 - 1807699
Alignment:
| Q |
154 |
aattgggttgtgtctaaattcataaagggtcatctaaaaatggtttctttttagttt--------tcaaattttcatcatggatcttgagtctgtg |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
1807604 |
aattgggttgtgtctaaattcataaagggtcatctaaaaatggtttctttttagttttcaaaacatcaaattttcatcatggatcttgagtctgtg |
1807699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University