View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0085_high_2 (Length: 263)
Name: NF0085_high_2
Description: NF0085
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0085_high_2 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 13 - 235
Target Start/End: Original strand, 40877816 - 40878038
Alignment:
| Q |
13 |
taggtcagattttaaaaaggacaaactgtcccaactcaaagagtaaaaagaaattaaatagactcaaaggccagctttgacaattttcttgataattttg |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
40877816 |
taggtcagattttaaaaaggacaaactgtcccaactcaaagagtaaaaagaaattaaatagactcaaaggccagctttgacaattttctagataattttg |
40877915 |
T |
 |
| Q |
113 |
tacaatgactcttgattttacattaaggtactactgacatatctgctggaaattacgtaaacgttgaagtattacatttgggtgattcagcatgtcgcag |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
40877916 |
tacaatgactcttgattttacattaaggtactactgacatatctgctggaaattacgtaaacgttgaagtattacgtttgggtgattcagcatgtcgcag |
40878015 |
T |
 |
| Q |
213 |
ttagtacgaagaaggcaagaact |
235 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
40878016 |
ttagtacgaagaaggcaagaact |
40878038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University