View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0085_high_3 (Length: 254)
Name: NF0085_high_3
Description: NF0085
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0085_high_3 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 53 - 206
Target Start/End: Complemental strand, 45565676 - 45565523
Alignment:
| Q |
53 |
tttctttgaagtgtgcttggaggtattcttcctactcttatgagacttcaagagagaggagttctatgttcaaatggatgtccccattgtgaaacaaact |
152 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
45565676 |
tttctttgaagtgtgcttggaggtattcttcctactcttatgagacttcaaaagagaggagttccatgttcaaatggatgtccccattgtgaaacaaact |
45565577 |
T |
|
| Q |
153 |
atgagaacgattggatgtaaagcggcaaaacaaatatggtgcgaggctgatctg |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45565576 |
atgagaacgattggatgtaaagcggcaaaacaaatatggtgcgaggctgatctg |
45565523 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 134 - 166
Target Start/End: Original strand, 45286940 - 45286972
Alignment:
| Q |
134 |
ccccattgtgaaacaaactatgagaacgattgg |
166 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |
|
|
| T |
45286940 |
ccccattgtgaaacaaactacgagaacgattgg |
45286972 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1359 times since January 2019
Visitors: 1298