View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0085_low_10 (Length: 209)
Name: NF0085_low_10
Description: NF0085
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0085_low_10 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 73; Significance: 2e-33; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 1 - 117
Target Start/End: Complemental strand, 22193193 - 22193077
Alignment:
Q |
1 |
gcataaataaacttaaagtatggtaactnnnnnnnnnnnngaaaccacaaaggaatatcttcgcgtaataaaaaaccatggatctgaatattatttacac |
100 |
Q |
|
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
T |
22193193 |
gcataaataaacttaaagtatggtaactaaaaataaaaaagaaaccacaaaggaatatcttcgcataataaaaaaccatggatctgaatattatttacac |
22193094 |
T |
 |
Q |
101 |
aaatttgtaagattgat |
117 |
Q |
|
|
|||||||| |||||||| |
|
|
T |
22193093 |
aaatttgttagattgat |
22193077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University