View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0085_low_12 (Length: 201)

Name: NF0085_low_12
Description: NF0085
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0085_low_12
NF0085_low_12
[»] chr4 (4 HSPs)
chr4 (52-188)||(33750436-33750572)
chr4 (52-188)||(33718963-33719099)
chr4 (52-188)||(33720982-33721118)
chr4 (52-188)||(33735636-33735772)
[»] chr7 (2 HSPs)
chr7 (136-188)||(6583050-6583102)
chr7 (136-188)||(6568891-6568943)
[»] chr6 (1 HSPs)
chr6 (145-188)||(13409878-13409921)


Alignment Details
Target: chr4 (Bit Score: 133; Significance: 2e-69; HSPs: 4)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 133; E-Value: 2e-69
Query Start/End: Original strand, 52 - 188
Target Start/End: Complemental strand, 33750572 - 33750436
Alignment:
52 aactcgatggcagcattgtcataagctctggcagcttcctccgccgtggaaaatgttccgagccaaacacaggtggcacgtctcgggtcacgaatttcag 151  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||    
33750572 aactcgatggcagcattgtcataagctctggcagcttcctccgccgtggaaaatgttccgagccaaacacgggtggcacgtctcgggtcacgaatttcag 33750473  T
152 cagcccatttaccccatggtctttgtctcactcctct 188  Q
    |||||||||||||||||||||||||||||||||||||    
33750472 cagcccatttaccccatggtctttgtctcactcctct 33750436  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 52 - 188
Target Start/End: Complemental strand, 33719099 - 33718963
Alignment:
52 aactcgatggcagcattgtcataagctctggcagcttcctccgccgtggaaaatgttccgagccaaacacaggtggcacgtctcgggtcacgaatttcag 151  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||     |||||||||||||||||||| ||||    
33719099 aactcgatggcggcattgtcataagctctggcagcttcctccgccgtggtaaaggttccgagccaaacacgaacagcacgtctcgggtcacgaatctcag 33719000  T
152 cagcccatttaccccatggtctttgtctcactcctct 188  Q
    |||||||||| ||||||||||| ||||||||||||||    
33718999 cagcccattttccccatggtctctgtctcactcctct 33718963  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 73; E-Value: 1e-33
Query Start/End: Original strand, 52 - 188
Target Start/End: Complemental strand, 33721118 - 33720982
Alignment:
52 aactcgatggcagcattgtcataagctctggcagcttcctccgccgtggaaaatgttccgagccaaacacaggtggcacgtctcgggtcacgaatttcag 151  Q
    |||||||| || |||||||| |||||||| ||||||||||||||||||| ||| ||||| ||||||||||     |||||||||||||||||||| ||||    
33721118 aactcgatagcggcattgtcgtaagctctagcagcttcctccgccgtggtaaaggttccaagccaaacacgaaccgcacgtctcgggtcacgaatctcag 33721019  T
152 cagcccatttaccccatggtctttgtctcactcctct 188  Q
    |||||||||| ||||||||||| || |||||||||||    
33721018 cagcccattttccccatggtctctgcctcactcctct 33720982  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 73; E-Value: 1e-33
Query Start/End: Original strand, 52 - 188
Target Start/End: Complemental strand, 33735772 - 33735636
Alignment:
52 aactcgatggcagcattgtcataagctctggcagcttcctccgccgtggaaaatgttccgagccaaacacaggtggcacgtctcgggtcacgaatttcag 151  Q
    ||||| || ||||||||||| |||||||||||||||||||||||||||| ||| ||||| |||||||||| |   |||||||| ||||||||||| ||||    
33735772 aactcaatagcagcattgtcgtaagctctggcagcttcctccgccgtggtaaaggttccaagccaaacacggaccgcacgtctagggtcacgaatctcag 33735673  T
152 cagcccatttaccccatggtctttgtctcactcctct 188  Q
    |||||||||| |||||||| || || |||||||||||    
33735672 cagcccattttccccatggcctctgcctcactcctct 33735636  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 136 - 188
Target Start/End: Complemental strand, 6583102 - 6583050
Alignment:
136 gggtcacgaatttcagcagcccatttaccccatggtctttgtctcactcctct 188  Q
    |||||||| |||||||| |||||||| ||||||||||||||||||||||||||    
6583102 gggtcacgtatttcagctgcccattttccccatggtctttgtctcactcctct 6583050  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 37; E-Value: 0.000000000004
Query Start/End: Original strand, 136 - 188
Target Start/End: Complemental strand, 6568943 - 6568891
Alignment:
136 gggtcacgaatttcagcagcccatttaccccatggtctttgtctcactcctct 188  Q
    |||||||| |||||||| |||||||| ||||||||||| ||||||||||||||    
6568943 gggtcacgtatttcagctgcccattttccccatggtctctgtctcactcctct 6568891  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 32; Significance: 0.000000004; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 145 - 188
Target Start/End: Complemental strand, 13409921 - 13409878
Alignment:
145 atttcagcagcccatttaccccatggtctttgtctcactcctct 188  Q
    ||||| || |||||||| ||||||||||||||||||||||||||    
13409921 atttctgctgcccattttccccatggtctttgtctcactcctct 13409878  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1529 times since January 2019
Visitors: 1302