View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0085_low_4 (Length: 254)

Name: NF0085_low_4
Description: NF0085
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0085_low_4
NF0085_low_4
[»] chr4 (1 HSPs)
chr4 (53-206)||(45565523-45565676)
[»] chr8 (1 HSPs)
chr8 (134-166)||(45286940-45286972)


Alignment Details
Target: chr4 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 53 - 206
Target Start/End: Complemental strand, 45565676 - 45565523
Alignment:
53 tttctttgaagtgtgcttggaggtattcttcctactcttatgagacttcaagagagaggagttctatgttcaaatggatgtccccattgtgaaacaaact 152  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||    
45565676 tttctttgaagtgtgcttggaggtattcttcctactcttatgagacttcaaaagagaggagttccatgttcaaatggatgtccccattgtgaaacaaact 45565577  T
153 atgagaacgattggatgtaaagcggcaaaacaaatatggtgcgaggctgatctg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45565576 atgagaacgattggatgtaaagcggcaaaacaaatatggtgcgaggctgatctg 45565523  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 134 - 166
Target Start/End: Original strand, 45286940 - 45286972
Alignment:
134 ccccattgtgaaacaaactatgagaacgattgg 166  Q
    |||||||||||||||||||| ||||||||||||    
45286940 ccccattgtgaaacaaactacgagaacgattgg 45286972  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1112 times since January 2019
Visitors: 1291