View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0085_low_5 (Length: 251)
Name: NF0085_low_5
Description: NF0085
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0085_low_5 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 122; Significance: 1e-62; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 21 - 150
Target Start/End: Original strand, 270836 - 270965
Alignment:
| Q |
21 |
agaacctgtgaatcacgctgcaggattgggaagggctttgggttttggcttgacttcaatctcgttcacactgcgaacgtagatagcatcttggtcatgg |
120 |
Q |
| |
|
|||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
270836 |
agaaccagtgaatcacgctgtaggattgggaagggctttgggttttggcttgacttcaatctcgttcacactgcgaacgtagatagcatcttggtcatgg |
270935 |
T |
|
| Q |
121 |
ctgcaaaagaaattaacaacagattagaga |
150 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
270936 |
ctgcaaaagaaattaacaacagattagaga |
270965 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 183 - 243
Target Start/End: Original strand, 270992 - 271052
Alignment:
| Q |
183 |
aatagggaatacttacggtttaggtccctcttcaaaagtgtaacttgatgcaacagctagg |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
270992 |
aatagggaatacttacggtttaggtccctcttcaaaagtgtaacttgatgcaacagctagg |
271052 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1026 times since January 2019
Visitors: 1289