View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0085_low_6 (Length: 238)
Name: NF0085_low_6
Description: NF0085
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0085_low_6 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 111; Significance: 4e-56; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 1 - 111
Target Start/End: Original strand, 25205461 - 25205571
Alignment:
| Q |
1 |
aagatgatatgcacgatgctcacgatatggagtcccttgaagatgacgatttctacagtggtgatacggaagaaggtgcgatggattattatagtgatta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25205461 |
aagatgatatgcacgatgctcacgatatggagtcccttgaagatgacgatttctacagtggtgatacggaagaaggtgcgatggattattatagtgatta |
25205560 |
T |
 |
| Q |
101 |
tgatgatgatg |
111 |
Q |
| |
|
||||||||||| |
|
|
| T |
25205561 |
tgatgatgatg |
25205571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 168 - 229
Target Start/End: Original strand, 30907576 - 30907637
Alignment:
| Q |
168 |
agccattcctgcctgcgctcctctgaccattctctgtaagatccaatctgcaggtgttttgt |
229 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||| ||||||||||||| || ||| ||||| |
|
|
| T |
30907576 |
agccattcctgcctgcgttcctcagaccattctcgataagatccaatctccaagtggtttgt |
30907637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 76; Significance: 3e-35; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 163 - 238
Target Start/End: Original strand, 39537782 - 39537857
Alignment:
| Q |
163 |
ataagagccattcctgcctgcgctcctctgaccattctctgtaagatccaatctgcaggtgttttgtaattgcgtc |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39537782 |
ataagagccattcctgcctgcgctcctctgaccattctctgtaagatccaatctgcaggtgttttgtaattgcgtc |
39537857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 165 - 235
Target Start/End: Original strand, 1552832 - 1552902
Alignment:
| Q |
165 |
aagagccattcctgcctgcgctcctctgaccattctctgtaagatccaatctgcaggtgttttgtaattgc |
235 |
Q |
| |
|
||||||||||| ||||||| |||||||||||||||| ||| |||||||||| || |||||| |||||||| |
|
|
| T |
1552832 |
aagagccattcttgcctgcattcctctgaccattctcggtatgatccaatctccaagtgtttcgtaattgc |
1552902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University