View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0085_low_9 (Length: 210)

Name: NF0085_low_9
Description: NF0085
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0085_low_9
NF0085_low_9
[»] chr6 (1 HSPs)
chr6 (1-101)||(28916582-28916682)


Alignment Details
Target: chr6 (Bit Score: 69; Significance: 4e-31; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 1 - 101
Target Start/End: Complemental strand, 28916682 - 28916582
Alignment:
1 gaatccttagtttttataatctgannnnnnnnaataaatatattttttagggtgtgcttcgtaatggtgtcgtggttgttgtcaagaaaatggtcggatc 100  Q
    ||||||||||||||||||||||||        ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||    
28916682 gaatccttagtttttataatctgattttttttaataaatatattttttagggtgttcttcgtaatggtgtcgtggttgttgtcaagaaaatgatcggatc 28916583  T
101 t 101  Q
    |    
28916582 t 28916582  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University