View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0086_low_1 (Length: 352)
Name: NF0086_low_1
Description: NF0086
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0086_low_1 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 127; Significance: 2e-65; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 127; E-Value: 2e-65
Query Start/End: Original strand, 104 - 280
Target Start/End: Complemental strand, 56178224 - 56178048
Alignment:
Q |
104 |
tggtagacctacataaacatataattctgattgtcttnnnnnnnnnnctaggaaattgggatatacatgatgatggagtaaccagaaccaaacaatcatt |
203 |
Q |
|
|
||||||||||||||| |||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
56178224 |
tggtagacctacatatacatataaatctgattgtcttaaaaaaaatactaggaaattgggatatacatgatgatggagtaaccagaaccaaacaatcatt |
56178125 |
T |
 |
Q |
204 |
tacaagtcattcctaagaaaacttcttttacacaattacctattctttggtagaaaagaaatcagtacctatgatac |
280 |
Q |
|
|
||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
T |
56178124 |
tacaagtcattcctatgaaaacttcttttacacaattacctattctttggaggaaaagaaatcagtacctatgatac |
56178048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1454 times since January 2019
Visitors: 1299