View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0086_low_2 (Length: 281)

Name: NF0086_low_2
Description: NF0086
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0086_low_2
NF0086_low_2
[»] chr1 (1 HSPs)
chr1 (113-142)||(49310645-49310674)


Alignment Details
Target: chr1 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 113 - 142
Target Start/End: Complemental strand, 49310674 - 49310645
Alignment:
113 tagatagtgaaagaaagagagagaatatac 142  Q
    ||||||||||||||||||||||||||||||    
49310674 tagatagtgaaagaaagagagagaatatac 49310645  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University