View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0086_low_2 (Length: 281)
Name: NF0086_low_2
Description: NF0086
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0086_low_2 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 113 - 142
Target Start/End: Complemental strand, 49310674 - 49310645
Alignment:
Q |
113 |
tagatagtgaaagaaagagagagaatatac |
142 |
Q |
|
|
|||||||||||||||||||||||||||||| |
|
|
T |
49310674 |
tagatagtgaaagaaagagagagaatatac |
49310645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University