View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0086_low_4 (Length: 268)
Name: NF0086_low_4
Description: NF0086
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0086_low_4 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 1 - 178
Target Start/End: Complemental strand, 32130021 - 32129844
Alignment:
| Q |
1 |
gagacatagctgtaattttgaatattaaagttaggaacatattcatggattagccatcatgtgacatatagtcagtcacatttcacatggttataattgc |
100 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32130021 |
gagacatagctgtaattttgcatattaaagttaggaacatattcatggattagccatcatgtgacatatagtcagtcacatttcacatggttataattgc |
32129922 |
T |
|
| Q |
101 |
aattcacttgactgtgtgatgctaaagggtggctagaaaaccccactggnnnnnnnnaccctaaattttttacctctg |
178 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
32129921 |
aattcacttgactgtgtgatgctaaagggtggctagaaaaccccactggttttttttaccctaaattttttacctctg |
32129844 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1571 times since January 2019
Visitors: 1302