View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0086_low_5 (Length: 207)
Name: NF0086_low_5
Description: NF0086
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0086_low_5 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 74; Significance: 4e-34; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 1 - 86
Target Start/End: Original strand, 40749994 - 40750079
Alignment:
| Q |
1 |
aacttcacattttttaagatgaaaagataggttgtctaagcttcgaatctcaatctctacatatattactctacaaatcacctgac |
86 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40749994 |
aacttcacattttttaaaatgaaaagataggttgtctaagctttgaatttcaatctctacatatattactctacaaatcacctgac |
40750079 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1332 times since January 2019
Visitors: 1298