View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0087-Insertion-13 (Length: 376)
Name: NF0087-Insertion-13
Description: NF0087
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0087-Insertion-13 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 135; Significance: 3e-70; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 135; E-Value: 3e-70
Query Start/End: Original strand, 150 - 373
Target Start/End: Original strand, 56051976 - 56052201
Alignment:
| Q |
150 |
taacttccactgtttggcaaagcgaagaaatacaagag--agaccaaaaatccatgggatccactaactttttgtttctctgctgttgagcgaagaaagc |
247 |
Q |
| |
|
||||||||||||||||||| | | ||||||||||||| ||||||||||||||| ||| |||| |||||||||||||||| || ||||||||||||||| |
|
|
| T |
56051976 |
taacttccactgtttggcataacatagaaatacaagagagagaccaaaaatccataggacccaccaactttttgtttctcttctcttgagcgaagaaagc |
56052075 |
T |
|
| Q |
248 |
caagagagatgaccaatgttttgcattttccatttataccctcgtcttcattgttcctctttttgcctaaaacttttgtacagtaaccaagctatactta |
347 |
Q |
| |
|
||||||||||||||||| ||||||||| | | ||||||||||||||||||||| | |||||||||||||||||||||| ||||| ||||| ||||||||| |
|
|
| T |
56052076 |
caagagagatgaccaatattttgcattcttcgtttataccctcgtcttcattgcttctctttttgcctaaaacttttgcacagtgaccaaactatactta |
56052175 |
T |
|
| Q |
348 |
tatctacaatccagatcagtgagtca |
373 |
Q |
| |
|
|||||| |||||||||||||||||| |
|
|
| T |
56052176 |
catctactatccagatcagtgagtca |
56052201 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 92; Significance: 1e-44; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 264 - 375
Target Start/End: Complemental strand, 9349866 - 9349755
Alignment:
| Q |
264 |
tgttttgcattttccatttataccctcgtcttcattgttcctctttttgcctaaaacttttgtacagtaaccaagctatacttatatctacaatccagat |
363 |
Q |
| |
|
|||||||||||||||||||||||| | |||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||| |
|
|
| T |
9349866 |
tgttttgcattttccatttataccattgtcttcattgctcctctttttgcctaaaacttttgtacagtgaccaagctatacttatatctactatccagat |
9349767 |
T |
|
| Q |
364 |
cagtgagtcacc |
375 |
Q |
| |
|
|||||||||||| |
|
|
| T |
9349766 |
cagtgagtcacc |
9349755 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1130 times since January 2019
Visitors: 1291