View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0087-Insertion-17 (Length: 232)
Name: NF0087-Insertion-17
Description: NF0087
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0087-Insertion-17 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 8 - 228
Target Start/End: Original strand, 16085285 - 16085505
Alignment:
| Q |
8 |
atttctgttaaatcttaattttgtttcattggtagtagtagtttaagtgctagggatcatcgtgggagctatgtaaatgtctttattagtattagtttca |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16085285 |
atttctgttaaatcttaattttgtttcattggtagtagtagtttaagtgctagggatcatcatgggagctatgtaaatgtctttattagtattagtttca |
16085384 |
T |
|
| Q |
108 |
ttcagttttatttattgcttgttttactgttgttggtggatgcatgttttgtttcaatttggtctttatgaagatatcatttgtagctcatatattctgc |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
16085385 |
ttcagttttatttattgcttgttttactgttgttggtggatgcatgttttgtttcaatttggtctttatgaagatatcatttgaagctcatatattctgc |
16085484 |
T |
|
| Q |
208 |
atctttttaatatggcttttt |
228 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
16085485 |
atctttttaatatggcttttt |
16085505 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1185 times since January 2019
Visitors: 1293