View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0087-Insertion-21 (Length: 44)
Name: NF0087-Insertion-21
Description: NF0087
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0087-Insertion-21 |
 |  |
|
[»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 37; Significance: 0.0000000000007; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 37; E-Value: 0.0000000000007
Query Start/End: Original strand, 8 - 44
Target Start/End: Complemental strand, 32214615 - 32214579
Alignment:
Q |
8 |
ctttcagttactacttactagtgtgtttaatgaatga |
44 |
Q |
|
|
||||||||||||||||||||||||||||||||||||| |
|
|
T |
32214615 |
ctttcagttactacttactagtgtgtttaatgaatga |
32214579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University