View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0087-Insertion-7 (Length: 449)
Name: NF0087-Insertion-7
Description: NF0087
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0087-Insertion-7 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 226; Significance: 1e-124; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 163 - 400
Target Start/End: Original strand, 7240236 - 7240473
Alignment:
| Q |
163 |
tataaaccctttttctccattaaccaatcactattatggcgaccctttattcaactcattgtcgttcattcccatcttcatcttcatttccatcttcttc |
262 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||| |
|
|
| T |
7240236 |
tataaaccctttttctccattaatcaatcactattatggcgaccctttattcaactcattgtcgttcattcccatcttcttcttcgtttccatcttcttc |
7240335 |
T |
|
| Q |
263 |
tttgtcgtctaaccaatctgctgttactttctctaaccgttttcttgctgctactgtctctctcaaatctcaacacaatttgttacaacaggtttcagtt |
362 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7240336 |
tttgtcgtctaaccaatctgctgttactttctctaaccgttttcttgctgctactgtctctctcaaatctcaacacaatttgttacaacaggtttcagtt |
7240435 |
T |
|
| Q |
363 |
catactcaacaacatgatggttagtttcttgaataccc |
400 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7240436 |
catactcaacaacatgatggttagtttcttgaataccc |
7240473 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 8 - 73
Target Start/End: Original strand, 7240077 - 7240142
Alignment:
| Q |
8 |
gtattgtccttcaacacccaacaagggaaagggacaagacaagcagcccttcggagatctcaagag |
73 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7240077 |
gtattgtccttcaacacccaacaagggaaagggacaagacaagcagcccttcggagatctcaagag |
7240142 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 868 times since January 2019
Visitors: 1286