View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0087_low_10 (Length: 324)
Name: NF0087_low_10
Description: NF0087
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0087_low_10 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 140; Significance: 3e-73; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 140; E-Value: 3e-73
Query Start/End: Original strand, 84 - 227
Target Start/End: Complemental strand, 12880008 - 12879865
Alignment:
| Q |
84 |
cagagagaataccgaaacataaagaataacaaactaaacattactgcattagtcgaaatattgatatgatactgatgagaattcctatgaaatatagttt |
183 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
12880008 |
cagagagaataccgaaacataaagaataacaaactaaacattactgcattagtcgaaatattgatatgatactgatgagaattcctacgaaatatagttt |
12879909 |
T |
 |
| Q |
184 |
cttacaaatcatagaaataacataacatgaataaatgttcttga |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12879908 |
cttacaaatcatagaaataacataacatgaataaatgttcttga |
12879865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University