View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0087_low_13 (Length: 288)
Name: NF0087_low_13
Description: NF0087
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0087_low_13 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 64; Significance: 5e-28; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 155 - 239
Target Start/End: Original strand, 1807604 - 1807696
Alignment:
| Q |
155 |
aattgggttgtgtctaaattcataaagggtcatctaaaaatggtttctttttagttt--------tcaaattttcatcatggatcttgagtct |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
1807604 |
aattgggttgtgtctaaattcataaagggtcatctaaaaatggtttctttttagttttcaaaacatcaaattttcatcatggatcttgagtct |
1807696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University