View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0087_low_15 (Length: 261)
Name: NF0087_low_15
Description: NF0087
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0087_low_15 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 23 - 168
Target Start/End: Original strand, 36400972 - 36401117
Alignment:
| Q |
23 |
gtgcctaaaaaagttttcaatttttaaaatatgaaaattaacttagaagaaagattttttagcaggaggtcttccaactgctctcataagattagcaatc |
122 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36400972 |
gtgcctaaaaaagttttcaatttttaaaatatgaaaactaacttagaagaaagattttttagcaggaggtcttccaactgctctcataagattagcaatc |
36401071 |
T |
 |
| Q |
123 |
tcaagaactctagccactttagttcctctttttgcctctgctgatg |
168 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36401072 |
tcaagaactctagccactttagttcctctttttgcctctgctgatg |
36401117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 64 - 168
Target Start/End: Original strand, 21427486 - 21427590
Alignment:
| Q |
64 |
cttagaagaaagattttttagcaggaggtcttccaactgctctcataagattagcaatctcaagaactctagccactttagttcctctttttgcctctgc |
163 |
Q |
| |
|
|||| ||||| ||| |||| | ||||| ||||||||| |||||||||| || |||||||||||||| || | | ||||||||||||||| |||||||| |
|
|
| T |
21427486 |
cttaaaagaaggatcttttggaaggagctcttccaacaactctcataaggttggcaatctcaagaacccttgaaattttagttcctcttttagcctctgc |
21427585 |
T |
 |
| Q |
164 |
tgatg |
168 |
Q |
| |
|
|||| |
|
|
| T |
21427586 |
agatg |
21427590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University