View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0087_low_6 (Length: 380)
Name: NF0087_low_6
Description: NF0087
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0087_low_6 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 60 - 292
Target Start/End: Original strand, 16490631 - 16490864
Alignment:
| Q |
60 |
cttttgattgttggcaggatcctggttgttgattggagatggtttgtttgctcgatctttttgttttaaaaattgaaaaatgaaggcagaaatatactgc |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16490631 |
cttttgattgttggcaggatcctggttgttgattggagatggtttgtttgctcgatctttttgttttaaaaattgaaaaatgaaggcagaaatatactgc |
16490730 |
T |
 |
| Q |
160 |
cagcttcaatgtattcatcgtgtagacgataaaataagatatatttgacacaacctcaaatttcttgtgctttaaattctgttggatatgtgaaaa-aca |
258 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
16490731 |
cagcttcaatgtattcatcgtgtagacgataaaataagatatatttgacacaacctcaaatttcttgtgctttaaattctgttggatatgtgaaaaggca |
16490830 |
T |
 |
| Q |
259 |
tacctgttcgctttggtccttgtgatttgatgat |
292 |
Q |
| |
|
||| |||||||||||||||||||||||||||||| |
|
|
| T |
16490831 |
tacttgttcgctttggtccttgtgatttgatgat |
16490864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University