View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0088_high_11 (Length: 292)
Name: NF0088_high_11
Description: NF0088
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0088_high_11 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 30 - 282
Target Start/End: Original strand, 28543939 - 28544191
Alignment:
| Q |
30 |
cttttctactcattacgattaattcagctgggtgtgtcattgaaacaatatatatcgtcacatacctaatctacgccaccaaagatgcgagggtaaaccc |
129 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||| |
|
|
| T |
28543939 |
cttttctactcattaccattaattcagctgggtgtgtcattgaaacaatatatatcgtcacatacctaatctacgccacgaaagatgcaagggtaaaccc |
28544038 |
T |
 |
| Q |
130 |
taatcaccgattatacttacnnnnnnnnnnnnnnnnnnnactaatcaacttgatatgacaagtataatctcattagttttgttctaacatgatttttaat |
229 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28544039 |
taatcaccgattatacttactttttagttttatttttttactaatcaacttgatatgacaagtataatctcattagttttgttctaacatgatttttaat |
28544138 |
T |
 |
| Q |
230 |
catagatcttgacgattaaattgttcatggcgatgaatgtggcctgttctgtg |
282 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28544139 |
cgtagatcttgacgattaaattgttcatggcgatgaatgtggcctgttctgtg |
28544191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University