View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0088_high_18 (Length: 254)
Name: NF0088_high_18
Description: NF0088
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0088_high_18 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 1 - 225
Target Start/End: Complemental strand, 8452508 - 8452284
Alignment:
Q |
1 |
aataaaatggttattaatttcttcttgcttcatttttcaaatacgcatatcccaatatcactgcaatctgaacttgcattcaaaaatggacttaacttgt |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
8452508 |
aataaaatggttattaatttcttcttgcttcatttttcaaatacgcatatcccaatatcactgcaatctgaacttgcattcaaaaatggacttaacttgt |
8452409 |
T |
 |
Q |
101 |
tctcttcatctctattaccctgctgcagtaacatcaatgccatgtccgagctaggattattatttgttccaaaacttgacaacaacactccttgatcagt |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
8452408 |
tctcttcatctctattaccctgctgcagtaacatcaatgccatgtccgagctaggattattatttgttccaaaacttgacaacaacactccttgatcagt |
8452309 |
T |
 |
Q |
201 |
ttcaacttcgtgactcagttgagaa |
225 |
Q |
|
|
||||||||||||||||||||||||| |
|
|
T |
8452308 |
ttcaacttcgtgactcagttgagaa |
8452284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1686 times since January 2019
Visitors: 1304