View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0088_high_7 (Length: 337)
Name: NF0088_high_7
Description: NF0088
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0088_high_7 |
 |  |
|
[»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 307; Significance: 1e-173; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 307; E-Value: 1e-173
Query Start/End: Original strand, 11 - 337
Target Start/End: Original strand, 2794357 - 2794683
Alignment:
Q |
11 |
cagagattgatccagaaaattgtcgaaggcttgctgaagaggtgttgaaggttttgggtgaggctgatgaccgagaagtggagaagaggttgctggggta |
110 |
Q |
|
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||| |
|
|
T |
2794357 |
cagagattgatccggaaaattgtcgaaggcttgctgaagaggtgttgaaggttttgggtgaggctgatgacagagaagtggagaagaggttgttggggta |
2794456 |
T |
 |
Q |
111 |
ttttgatttgaataagtttagtcttgttaagtttctgatgcagaataagttgaagattgtgtggtgtactagcttggccagggcgagggatcaagaagag |
210 |
Q |
|
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
2794457 |
ttttgatttgaataagtttagtcttgttaagtttctaatgcagaataagttgaagattgtgtggtgtactagcttggccagggcgagggatcaagaagag |
2794556 |
T |
 |
Q |
211 |
agggataaaattgaggaagagatgaaggggtcgaatttggagtcaattttggaggagttatatgttgtgaaagcctctactatagagagggagaagaact |
310 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
T |
2794557 |
agggataaaattgaggaagagatgaaggggtcgaatttggagtcaattttggaggagttatatgctgtgaaagcctctactatagagagggagaagaact |
2794656 |
T |
 |
Q |
311 |
tggagaagagtataaggtacgaggctc |
337 |
Q |
|
|
||||||||||||||||||||||||||| |
|
|
T |
2794657 |
tggagaagagtataaggtacgaggctc |
2794683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 122 - 238
Target Start/End: Original strand, 29261933 - 29262049
Alignment:
Q |
122 |
ataagtttagtcttgttaagtttctgatgcagaataagttgaagattgtgtggtgtactagcttggccagggcgagggatcaagaagagagggataaaat |
221 |
Q |
|
|
|||||||||||||| |||||||| || ||| |||| | |||| ||| ||||||||||| | ||||| ||||| ||||| |||||||| || | || |
|
|
T |
29261933 |
ataagtttagtcttattaagtttttgttgcgaaataggctgaaaattttgtggtgtactcgtttggcgagggcacaagatcaggaagagagagagacgat |
29262032 |
T |
 |
Q |
222 |
tgaggaagagatgaagg |
238 |
Q |
|
|
||||||||||||||||| |
|
|
T |
29262033 |
tgaggaagagatgaagg |
29262049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1730 times since January 2019
Visitors: 1304