View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0088_high_8 (Length: 322)
Name: NF0088_high_8
Description: NF0088
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0088_high_8 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 139; Significance: 1e-72; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 139; E-Value: 1e-72
Query Start/End: Original strand, 1 - 147
Target Start/End: Complemental strand, 27939624 - 27939478
Alignment:
| Q |
1 |
tcctcattctcctccttgttctctcaattttcattattttcgcattctcttcttctaaactggtatgctcgtatgacccttttgtttatatattgctgtc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
27939624 |
tcctcattctcctccttgttctctcaattttcattattttcgcattctcttcttctaaactggtatgctcttatgacccttttgtctatatattgctgtc |
27939525 |
T |
|
| Q |
101 |
attgtggatctgatctgggttattgataatatgaattaaaaatgtga |
147 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27939524 |
attgtggatctgatctgggttattgataatatgaattaaaaatgtga |
27939478 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 57; Significance: 9e-24; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 256 - 316
Target Start/End: Complemental strand, 40322514 - 40322454
Alignment:
| Q |
256 |
cagatccacaaatttggggtgggatttctgcaaaattttaccaaaatcgaactttaatatg |
316 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40322514 |
cagatccacaaatttggggtggaatttctgcaaaattttaccaaaatcgaactttaatatg |
40322454 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 55; Significance: 1e-22; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 263 - 317
Target Start/End: Original strand, 9071223 - 9071277
Alignment:
| Q |
263 |
acaaatttggggtgggatttctgcaaaattttaccaaaatcgaactttaatatgt |
317 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9071223 |
acaaatttggggtgggatttctgcaaaattttaccaaaatcgaactttaatatgt |
9071277 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 256 - 316
Target Start/End: Complemental strand, 28223198 - 28223138
Alignment:
| Q |
256 |
cagatccacaaatttggggtgggatttctgcaaaattttaccaaaatcgaactttaatatg |
316 |
Q |
| |
|
|||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28223198 |
cagatccagaaatttgaggtgggatttctgcaaaattttaccaaaatcgaactttaatatg |
28223138 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 52; Significance: 8e-21; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 258 - 317
Target Start/End: Original strand, 45518731 - 45518790
Alignment:
| Q |
258 |
gatccacaaatttggggtgggatttctgcaaaattttaccaaaatcgaactttaatatgt |
317 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
45518731 |
gatccacaaatttggggtggaatttctgcaaaattttaccaaaatcgaattttaatatgt |
45518790 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1076 times since January 2019
Visitors: 1291