View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0088_high_9 (Length: 309)
Name: NF0088_high_9
Description: NF0088
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0088_high_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 31 - 289
Target Start/End: Complemental strand, 34776715 - 34776463
Alignment:
| Q |
31 |
taatttacttatttggttaatccaaaatatgcatcttaatttgttactagttactaccattttatccttattagcaaaagttatgtaacacagacacttc |
130 |
Q |
| |
|
||||||| |||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||| || ||||||||| |
|
|
| T |
34776715 |
taatttagttatttggttaatccaaaatat------taatttattactagttactaccattttatccttattagcaaaagttatgtagcagagacacttc |
34776622 |
T |
 |
| Q |
131 |
agattgaaggtaatgtatcctacacattttaatgtctaacattatctcaacatggacacatgttaataaattgaaacaatttcattgactaaatttaatt |
230 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34776621 |
ggattgaaagtaatgtatcctacacattttaatgtctaacattatctcaacacggacacatgttaataaattgaaacaatttcattgactaaatttaatt |
34776522 |
T |
 |
| Q |
231 |
ctggtgtctgtgtcattgtcaatattgtatccggtgtgtgcagtgtcagtgtctgtgct |
289 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
34776521 |
ctggtgtctgtgtcattgtcaatattgtgtccggtgtgtgcagtgtcagtgtctgtgct |
34776463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University