View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0088_low_10 (Length: 353)
Name: NF0088_low_10
Description: NF0088
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0088_low_10 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 9 - 255
Target Start/End: Original strand, 2794575 - 2794821
Alignment:
| Q |
9 |
gagatgaaggggtcgaatttggagtcaattttggaggagttatatgttgtgaaagcctctactatagagagggagaagaacttggagaagagtataaggt |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2794575 |
gagatgaaggggtcgaatttggagtcaattttggaggagttatatgctgtgaaagcctctactatagagagggagaagaacttggagaagagtataaggt |
2794674 |
T |
|
| Q |
109 |
acgaggctcgaaggttgaaagacggggacatggacattgataggggaactggtgatggagttggggaaaatgggggtcaatgccggatacttgatttgga |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||| |
|
|
| T |
2794675 |
acgaggctcgaaggttgaaagacggggacatggacattgataggggaactggtgatggagttggggaaaatgggggtcaacgccggatgcttgatttgga |
2794774 |
T |
|
| Q |
209 |
taaccttgcttttgaacaaggtggtttgtttatgacaaagggaaaat |
255 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2794775 |
taaccttgcttttgaacaaggtggtttgtttatgacaaagggaaaat |
2794821 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1589 times since January 2019
Visitors: 1303