View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0088_low_12 (Length: 344)
Name: NF0088_low_12
Description: NF0088
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0088_low_12 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 53 - 310
Target Start/End: Original strand, 43256521 - 43256777
Alignment:
| Q |
53 |
ctgacaaagccctagctgttgcaataaaccccagatgagcagcttgtcccccatgagacatgagggccacaggtgttgaaggtttacacaaggtggggaa |
152 |
Q |
| |
|
||||| |||||| ||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43256521 |
ctgacgaagcccatgcttttgcaataaaccc-agatgagcagcttgtcccccatgagacatgagggccacaggtgttgaaggtttacacaaggtggggaa |
43256619 |
T |
|
| Q |
153 |
atggggcagcggaaaaaattaagaggcaatatgtgttaataggaaccaggctctgtcgcagcccctttgaaatcctccagttccctctaagattaagtct |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43256620 |
atggggcagcggaaaaaattaagaggcaatatgtgttaataggaaccaggctctgtcgcagcccctttgaaatcctccagttccctctaagattaagtct |
43256719 |
T |
|
| Q |
253 |
tttctctgacgctccctcttttatttgaagttccctctacacatgcatgtcctgatga |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43256720 |
tttctctgacgctccctcttttatttgaagttccctctacacatgcatgtcctgatga |
43256777 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1578 times since January 2019
Visitors: 1303