View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0088_low_32 (Length: 268)
Name: NF0088_low_32
Description: NF0088
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0088_low_32 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 161; Significance: 6e-86; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 161; E-Value: 6e-86
Query Start/End: Original strand, 1 - 173
Target Start/End: Original strand, 32129997 - 32130169
Alignment:
| Q |
1 |
atattcaaaattacagctatgtctcatcattttagcactccttcattgccttatgtgattcttctattcattcaacaattgcacattgcaacttcacttc |
100 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32129997 |
atatgcaaaattacagctatgtctcatcattttagcactccttcattgccttatgtgattcttctattcattcaacaattgcacattgcaacttcacttc |
32130096 |
T |
|
| Q |
101 |
tctaccccataacaaatgttttggcacccttctagtaagacattaagattgctaaatctaagggtggccttac |
173 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
32130097 |
tctgccccataacaaatgttttggcacccttctagtaagacattaagattgctaaatctaaggttggccttac |
32130169 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1530 times since January 2019
Visitors: 1302