View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0088_low_33 (Length: 264)
Name: NF0088_low_33
Description: NF0088
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0088_low_33 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 30 - 239
Target Start/End: Complemental strand, 35630191 - 35629982
Alignment:
| Q |
30 |
ctaagaagcacggattgaagcttcacattgatggagcccgtatttttaatgcatcagccgtaagtatctctgtattttaatcttgatttcacctaagttt |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
35630191 |
ctaagaagcacggattgaagcttcacattgatggagcccgtatttttaatgcatcagctgtaagtaaatctgtattttaatcttgatttcacctaagttt |
35630092 |
T |
 |
| Q |
130 |
tatgaataaagcattatagcgtatcagttgatttgttttacttagttagtataagcgtttctgtaaataatacatgatagtcaatgatctctaatgatat |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
35630091 |
tatgaataaagcattatagcgtatcagttgatttgttttacttagttagtataagcgtttctgtaaataatacatgatagccaatgatctctaatgatat |
35629992 |
T |
 |
| Q |
230 |
aatcatgtct |
239 |
Q |
| |
|
|||||||||| |
|
|
| T |
35629991 |
aatcatgtct |
35629982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 47827374 - 47827430
Alignment:
| Q |
30 |
ctaagaagcacggattgaagcttcacattgatggagcccgtatttttaatgcatcag |
86 |
Q |
| |
|
||||| |||| ||| ||||||||||||| |||||||||||||| ||||||||||||| |
|
|
| T |
47827374 |
ctaagcagcatggactgaagcttcacatcgatggagcccgtatatttaatgcatcag |
47827430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University