View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0088_low_34 (Length: 263)
Name: NF0088_low_34
Description: NF0088
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0088_low_34 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 25 - 237
Target Start/End: Complemental strand, 37143658 - 37143446
Alignment:
| Q |
25 |
agagacaaaaggagctgtttactgcttgaacgcgtttaatggtaaattgctcgctgctattaatcaaaagattcagctgtacaagtgggtgctccgggaa |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37143658 |
agagacaaaaggagctgtttactgcttgaacgcgtttaatggtaaattgctcgctgctattaatcaaaagattcagctgtacaagtgggtgctccgggaa |
37143559 |
T |
 |
| Q |
125 |
gatggtactcgtgaattacagtctgaatgtggacaccacgggcacatactggctttatatgtgcaaactagaggagattttattgtagtcggtgatctga |
224 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37143558 |
gacggtactcgtgaattacagtctgaatgtggacaccacgggcacatactggctttatatgtgcaaactagaggagattttattgtagtcggtgatctga |
37143459 |
T |
 |
| Q |
225 |
tgatgtccatctc |
237 |
Q |
| |
|
||| ||||||||| |
|
|
| T |
37143458 |
tgaagtccatctc |
37143446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University