View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0088_low_39 (Length: 248)
Name: NF0088_low_39
Description: NF0088
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0088_low_39 |
 |  |
|
[»] scaffold0160 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0160 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: scaffold0160
Description:
Target: scaffold0160; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 9 - 190
Target Start/End: Complemental strand, 29939 - 29758
Alignment:
Q |
9 |
acactgaaggctctaaaagctgaaattatggctaaaacaaagaagcagccaaaagtaatcatatggaggatcaaagccagcttgactttgctgcaaaatt |
108 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
T |
29939 |
acactgaaggctctaaaagctgaaattatggctaaaacaaagaagcagccaaaagtaatcatatggaggatcaaagccagcttcactttgctgcaaaatt |
29840 |
T |
 |
Q |
109 |
ttccataagaactgcaggcttgactccaagaatcttctctagcaccattataagcaaggtaatatatctccattgttgcagc |
190 |
Q |
|
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
T |
29839 |
ttccgtaagaactgcaggcttgactccaagaatcttctctagcaccattataagcaaggtaatatatctccattgtagcagc |
29758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University