View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0088_low_4 (Length: 522)
Name: NF0088_low_4
Description: NF0088
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0088_low_4 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 209; Significance: 1e-114; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 103 - 315
Target Start/End: Complemental strand, 6171189 - 6170977
Alignment:
Q |
103 |
aaatgtccctgaatgaattgatcttttttgcgaaattggtgacggttgagcttgagcaacggccgatttaggttgtgtttgtttgtcgggtgtttggttt |
202 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
6171189 |
aaatgtccctgaatgaattgatcttttttgcgaaattggtgacggttgagcttgagcaacgaccgatttaggttgtgtttgtttgtcgggtgtttggttt |
6171090 |
T |
 |
Q |
203 |
tcgttgccctactggttatgtcttgctctggtactcacgagtttttgctattggtgtttttaagttgcggtctccctctttaacctttgcacgttggagt |
302 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
6171089 |
tcgttgccctactggttatgtcttgctctggtactcacgagtttttgctattggtgtttttaagttgcggtctccctctttaacctttgcacgttggagt |
6170990 |
T |
 |
Q |
303 |
ttatatctcttcg |
315 |
Q |
|
|
||||||||||||| |
|
|
T |
6170989 |
ttatatctcttcg |
6170977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 114; E-Value: 1e-57
Query Start/End: Original strand, 388 - 522
Target Start/End: Complemental strand, 6170904 - 6170770
Alignment:
Q |
388 |
atgtatattttgtttataattnnnnnnntgcatatgatctactcacttggctaatgacaaatttccaccgaagtttttgattgaaccaccccacctttat |
487 |
Q |
|
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
6170904 |
atgtatattttgtttataattaaaaaaatgcatatgatctactcacttggctaatgacaaatttccaccgaagtttttgattgaaccaccccacctttat |
6170805 |
T |
 |
Q |
488 |
agtcattttttgtgtctacaaagttcaatttgcca |
522 |
Q |
|
|
||||||||||||||||||||||||||||||||||| |
|
|
T |
6170804 |
agtcattttttgtgtctacaaagttcaatttgcca |
6170770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University