View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0089_high_8 (Length: 298)

Name: NF0089_high_8
Description: NF0089
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0089_high_8
NF0089_high_8
[»] chr4 (1 HSPs)
chr4 (78-238)||(35762286-35762446)


Alignment Details
Target: chr4 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 78 - 238
Target Start/End: Original strand, 35762286 - 35762446
Alignment:
78 ctatattacttgtttcctacaccaaattggtaatacattgtagtgtttttatccaccatagccatggttaatatgactaggttacttctctgctcgattt 177  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35762286 ctatattacttgtttcctacaccaaattggtaatacattgtagtgtttttatccaccatagccatggttaatatgactaggttacttctctgctcgattt 35762385  T
178 tgcagtgtatagaggccgtttctgtgnnnnnnnaacagcataatttttgttgttgtttggt 238  Q
    ||||||||||||||||||||||||||       ||||||||||||||||||||||||||||    
35762386 tgcagtgtatagaggccgtttctgtgtttttttaacagcataatttttgttgttgtttggt 35762446  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 808 times since January 2019
Visitors: 1284