View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0089_high_9 (Length: 291)
Name: NF0089_high_9
Description: NF0089
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0089_high_9 |
 |  |
|
[»] scaffold1683 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr1 (Bit Score: 157; Significance: 2e-83; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 29 - 262
Target Start/End: Complemental strand, 39770664 - 39770437
Alignment:
Q |
29 |
acttgggaggtgactctttcaccttggtggatctgcatcatttaccctcccttcattacttgatgaagtcacatagcaagaaattgtttgaatcaagacc |
128 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
T |
39770664 |
acttgggaggtgactctttcaccttggtggatctgcatcacttaccctccctttattacttgatgaagtcacagagcaagaaattgtttgaatcaagacc |
39770565 |
T |
 |
Q |
129 |
atatgttagtgcttgggtagctgatatcactgcaagaccagcttggtctaaagtccttgccatgatacctaattaaaacnnnnnnnnnnnnnnnnggata |
228 |
Q |
|
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||| |
|
|
T |
39770564 |
ttatgttagtgcttgggtggctgatatcactgcaagaccagcttggtctaaagtccttgccatgatacctaattaagac------cttttttttgggata |
39770471 |
T |
 |
Q |
229 |
tttgggtgttgttttatggtttaagcaacttttt |
262 |
Q |
|
|
|||||||||||||||||||||||||||||||||| |
|
|
T |
39770470 |
tttgggtgttgttttatggtttaagcaacttttt |
39770437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 29 - 204
Target Start/End: Complemental strand, 41527514 - 41527339
Alignment:
Q |
29 |
acttgggaggtgactctttcaccttggtggatctgcatcatttaccctcccttcattacttgatgaagtcacatagcaagaaattgtttgaatcaagacc |
128 |
Q |
|
|
|||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||| ||||||||| ||||||||||| |||| |
|
|
T |
41527514 |
acttgggaggtgactctttcaccttggtggatttgcatcacttaccctcccttcattacttgatgaagtcacaaagcaagaaagtgtttgaatcacgacc |
41527415 |
T |
 |
Q |
129 |
atatgttagtgcttgggtagctgatatcactgcaagaccagcttggtctaaagtccttgccatgatacctaattaa |
204 |
Q |
|
|
||||||| ||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
41527414 |
ttatgttattgcttgggtggctgatatcactggaagaccagcttggtctaaagtccttgccatgatacctaattaa |
41527339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 29 - 204
Target Start/End: Complemental strand, 39755743 - 39755568
Alignment:
Q |
29 |
acttgggaggtgactctttcaccttggtggatctgcatcatttaccctcccttcattacttgatgaagtcacatagcaagaaattgtttgaatcaagacc |
128 |
Q |
|
|
|||| ||||||||||||||||||||||||||| ||||||||||||| || ||||||||||||||||||||||| |||||||| | |||||||||||||| |
|
|
T |
39755743 |
actttggaggtgactctttcaccttggtggatttgcatcatttaccttctcttcattacttgatgaagtcacaaagcaagaagctttttgaatcaagacc |
39755644 |
T |
 |
Q |
129 |
atatgttagtgcttgggtagctgatatcactgcaagaccagcttggtctaaagtccttgccatgatacctaattaa |
204 |
Q |
|
|
|||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
T |
39755643 |
tcatgttagtgcttgggtggctgatatcactgcaagaccagcttggtctgaagtccttgccatgatacctaattaa |
39755568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 29 - 204
Target Start/End: Complemental strand, 39761097 - 39760922
Alignment:
Q |
29 |
acttgggaggtgactctttcaccttggtggatctgcatcatttaccctcccttcattacttgatgaagtcacatagcaagaaattgtttgaatcaagacc |
128 |
Q |
|
|
|||| ||||||||||||||||||||||||||| ||||||||||||| || ||||||||||||||||||||||| |||||||| | |||||||||||||| |
|
|
T |
39761097 |
actttggaggtgactctttcaccttggtggatttgcatcatttaccttctcttcattacttgatgaagtcacaaagcaagaagctttttgaatcaagacc |
39760998 |
T |
 |
Q |
129 |
atatgttagtgcttgggtagctgatatcactgcaagaccagcttggtctaaagtccttgccatgatacctaattaa |
204 |
Q |
|
|
|||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
T |
39760997 |
tcatgttagtgcttgggtggctgatatcactgcaagaccagcttggtctgaagtccttgccatgatacctaattaa |
39760922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1683 (Bit Score: 72; Significance: 9e-33; HSPs: 1)
Name: scaffold1683
Description:
Target: scaffold1683; HSP #1
Raw Score: 72; E-Value: 9e-33
Query Start/End: Original strand, 29 - 136
Target Start/End: Complemental strand, 202 - 95
Alignment:
Q |
29 |
acttgggaggtgactctttcaccttggtggatctgcatcatttaccctcccttcattacttgatgaagtcacatagcaagaaattgtttgaatcaagacc |
128 |
Q |
|
|
||||||||||||||| |||||||||||||||| ||||||| ||||| |||||||||||||||||||||||||| ||||||||| ||||||||||| | || |
|
|
T |
202 |
acttgggaggtgactgtttcaccttggtggatttgcatcacttaccatcccttcattacttgatgaagtcacaaagcaagaaagtgtttgaatcacgtcc |
103 |
T |
 |
Q |
129 |
atatgtta |
136 |
Q |
|
|
||||||| |
|
|
T |
102 |
ttatgtta |
95 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University