View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0089_low_11 (Length: 301)
Name: NF0089_low_11
Description: NF0089
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0089_low_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 129; Significance: 9e-67; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 129; E-Value: 9e-67
Query Start/End: Original strand, 98 - 238
Target Start/End: Complemental strand, 23945205 - 23945065
Alignment:
Q |
98 |
ctttccactttaatccactcaccatgcaaagaatccggttcaccattaatacccaagatatcagttttgaacggaaactcctccatcattattcctgatt |
197 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
T |
23945205 |
ctttccactttaatccactcaccatgcaaagaatccggttcaccattaatacccaagatatcagttttgaacggaatctcctccatcattattcctgatt |
23945106 |
T |
 |
Q |
198 |
tttcgtttttaccgttacccacattaaagttgttaccgttc |
238 |
Q |
|
|
||||||||||||||||||||||||||| ||||||| ||||| |
|
|
T |
23945105 |
tttcgtttttaccgttacccacattaatgttgttatcgttc |
23945065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1424 times since January 2019
Visitors: 1299