View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0089_low_12 (Length: 301)
Name: NF0089_low_12
Description: NF0089
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0089_low_12 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 1 - 208
Target Start/End: Complemental strand, 43925734 - 43925527
Alignment:
| Q |
1 |
tatgatattctatttcagggtggacgatgcaattgatattatggagtacattgtagttgtgagggaggaaaaacttgggacagcacactttgatgttgtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43925734 |
tatgatattctatttcagggtggacgatgcaattgatattatagagtacattgtagttgtgagggaggaaaaacttgggacagcacactttgatgttgtt |
43925635 |
T |
|
| Q |
101 |
gatgagaagagaaggttggatgagttgttgaaggaaacaggcagagttcggaagagaaaaaccaagtcacttgagattcttcttgatgttaatgaggact |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43925634 |
gatgagaagagaaggttggatgagttgttgaaggaaacaggcagagttcggaagagaaaaaccaagtcacttgagattcttcttgatgttaatgaggact |
43925535 |
T |
|
| Q |
201 |
aatgatga |
208 |
Q |
| |
|
|||||||| |
|
|
| T |
43925534 |
aatgatga |
43925527 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1399 times since January 2019
Visitors: 1298