View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0089_low_14 (Length: 298)
Name: NF0089_low_14
Description: NF0089
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0089_low_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 78 - 238
Target Start/End: Original strand, 35762286 - 35762446
Alignment:
Q |
78 |
ctatattacttgtttcctacaccaaattggtaatacattgtagtgtttttatccaccatagccatggttaatatgactaggttacttctctgctcgattt |
177 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
35762286 |
ctatattacttgtttcctacaccaaattggtaatacattgtagtgtttttatccaccatagccatggttaatatgactaggttacttctctgctcgattt |
35762385 |
T |
 |
Q |
178 |
tgcagtgtatagaggccgtttctgtgnnnnnnnaacagcataatttttgttgttgtttggt |
238 |
Q |
|
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
T |
35762386 |
tgcagtgtatagaggccgtttctgtgtttttttaacagcataatttttgttgttgtttggt |
35762446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University