View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0089_low_18 (Length: 286)
Name: NF0089_low_18
Description: NF0089
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0089_low_18 |
 |  |
|
[»] chr4 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 96; Significance: 4e-47; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 96; E-Value: 4e-47
Query Start/End: Original strand, 187 - 286
Target Start/End: Complemental strand, 25645390 - 25645291
Alignment:
Q |
187 |
aaaatcatcgcacatgcatgcttgtgtttgtggacataaagagtccaagaatgtgttggaaaattgtgacaacatacaatgtcttcaacttgaagttcaa |
286 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
25645390 |
aaaatcatcgcacatgcatgcttgtgtttgtggacataaagagtctaagaatgtgttggaaaattgtgacaacatacaatgtcttcaacttgaagttcaa |
25645291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 178 - 283
Target Start/End: Original strand, 25941337 - 25941443
Alignment:
Q |
178 |
aaaagcaataaaatcatcgcacatgcatgcttgtgtttgtgg-acataaagagtccaagaatgtgttggaaaattgtgacaacatacaatgtcttcaact |
276 |
Q |
|
|
||||||||||||||||| |||||||||||||||||||||||| |||||||||| | |||| ||||||||||||||||| |||||||||||| ||||| || |
|
|
T |
25941337 |
aaaagcaataaaatcattgcacatgcatgcttgtgtttgtgggacataaagagcctaagattgtgttggaaaattgtggcaacatacaatgccttcacct |
25941436 |
T |
 |
Q |
277 |
tgaagtt |
283 |
Q |
|
|
||||||| |
|
|
T |
25941437 |
tgaagtt |
25941443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1649 times since January 2019
Visitors: 1303