View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0089_low_19 (Length: 272)
Name: NF0089_low_19
Description: NF0089
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0089_low_19 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 105; Significance: 2e-52; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 144 - 260
Target Start/End: Original strand, 409280 - 409396
Alignment:
Q |
144 |
caactccaacacttttggaaccatacccaacaacattaaactctctcatgctaactctcaacaacgttgttttgtggtcaacagtgttttaaaaactgtt |
243 |
Q |
|
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
T |
409280 |
caactccaacacttttggaatcatacccaacaacattaaactctctcatgctaactctcaacaacgttgttttatggtcaacagtgttttaaaaactgtt |
409379 |
T |
 |
Q |
244 |
gaccacacaaaacaaac |
260 |
Q |
|
|
||||| ||||||||||| |
|
|
T |
409380 |
gaccaaacaaaacaaac |
409396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University