View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0089_low_5 (Length: 367)
Name: NF0089_low_5
Description: NF0089
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0089_low_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 125; Significance: 3e-64; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 125; E-Value: 3e-64
Query Start/End: Original strand, 81 - 213
Target Start/End: Complemental strand, 52464708 - 52464576
Alignment:
Q |
81 |
agcacagacagaacccaaaaccccacctatagaactggtcaagtcggatccgatccacgattgtgattctcatgatgaggagaatagcaaaccgatgatg |
180 |
Q |
|
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
T |
52464708 |
agcacaaacagaacccaaaaccccacctatagaactggtcaagtcggatccgatccacgattgtgattctgatgatgaggagaatagcaaaccgatgatg |
52464609 |
T |
 |
Q |
181 |
aagaaatcagcgagcgagaaagagtgttcaatg |
213 |
Q |
|
|
||||||||||||||||||||||||||||||||| |
|
|
T |
52464608 |
aagaaatcagcgagcgagaaagagtgttcaatg |
52464576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University