View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0089_low_8 (Length: 352)
Name: NF0089_low_8
Description: NF0089
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0089_low_8 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 123; Significance: 4e-63; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 123; E-Value: 4e-63
Query Start/End: Original strand, 104 - 276
Target Start/End: Complemental strand, 56178224 - 56178052
Alignment:
| Q |
104 |
tggtagacctacataaacatataattctgattgtcttnnnnnnnnnnctaggaaattgggatatacatgatgatggagtaaccagaaccaaacaatcatt |
203 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56178224 |
tggtagacctacatatacatataaatctgattgtcttaaaaaaaatactaggaaattgggatatacatgatgatggagtaaccagaaccaaacaatcatt |
56178125 |
T |
|
| Q |
204 |
tacaagtcattcctaagaaaacttcttttacacaattacctattctttggtagaaaagaaatcagtacctatg |
276 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
56178124 |
tacaagtcattcctatgaaaacttcttttacacaattacctattctttggaggaaaagaaatcagtacctatg |
56178052 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 686 times since January 2019
Visitors: 1282