View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0090_high_6 (Length: 248)

Name: NF0090_high_6
Description: NF0090
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0090_high_6
NF0090_high_6
[»] chr3 (1 HSPs)
chr3 (1-219)||(52834761-52834979)


Alignment Details
Target: chr3 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 219
Target Start/End: Original strand, 52834761 - 52834979
Alignment:
1 tttagtcattgatacagaaaatgaaaagggaagagaatgaccaacatacatctcccagatgatgcctgaattgggaagaagaaccagcagtttcctttag 100  Q
    ||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
52834761 tttagtctttgatacagaaaatgaaaagggaagagaatgaacaacatacatctcccagatgatgcctgaattgggaagaagaaccagcagtttcctttag 52834860  T
101 gccatgccaggcttgttcatccacttcgaggaatctgttaatttttaccacagtttcttatcagagaaggaggatgtcaagttattccataagttcttgt 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
52834861 gccatgccaggcttgttcatccacttcgaggaatctgttaatttttaccacagtttcttatcagagaaggaggatgtcaagttattccataagttcttgt 52834960  T
201 attaatctaatttttaaat 219  Q
    |||||||||||||||||||    
52834961 attaatctaatttttaaat 52834979  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1403 times since January 2019
Visitors: 1298