View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0090_high_6 (Length: 248)
Name: NF0090_high_6
Description: NF0090
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0090_high_6 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 219
Target Start/End: Original strand, 52834761 - 52834979
Alignment:
Q |
1 |
tttagtcattgatacagaaaatgaaaagggaagagaatgaccaacatacatctcccagatgatgcctgaattgggaagaagaaccagcagtttcctttag |
100 |
Q |
|
|
||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
52834761 |
tttagtctttgatacagaaaatgaaaagggaagagaatgaacaacatacatctcccagatgatgcctgaattgggaagaagaaccagcagtttcctttag |
52834860 |
T |
 |
Q |
101 |
gccatgccaggcttgttcatccacttcgaggaatctgttaatttttaccacagtttcttatcagagaaggaggatgtcaagttattccataagttcttgt |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
52834861 |
gccatgccaggcttgttcatccacttcgaggaatctgttaatttttaccacagtttcttatcagagaaggaggatgtcaagttattccataagttcttgt |
52834960 |
T |
 |
Q |
201 |
attaatctaatttttaaat |
219 |
Q |
|
|
||||||||||||||||||| |
|
|
T |
52834961 |
attaatctaatttttaaat |
52834979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1403 times since January 2019
Visitors: 1298