View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0090_low_6 (Length: 289)
Name: NF0090_low_6
Description: NF0090
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0090_low_6 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 28 - 279
Target Start/End: Original strand, 44856376 - 44856627
Alignment:
Q |
28 |
catatcttccatgtaaacagaatcaaagttgactcctttatcaactctaaatatttgtaaacttggatgaactgaattagccaacaaatgaaccatccaa |
127 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
44856376 |
catatcttccatgtaaacagaatcaaagttgactcctttatcaactctaaatatttgtaaacttggatgaactgaattagccaacaaatgaaccatccaa |
44856475 |
T |
 |
Q |
128 |
acactctttgaagcaacaaagaaagcttgcaatagtggttcagaccaagccctattccaacccaacatagcaacaatttcactcatttttctatcacaaa |
227 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
44856476 |
acactctttgaagcaacaaagaaagcttgcaatagtggttcagaccaagccctattccaacccaacatagcaacaatttcactcatttttctatcacaaa |
44856575 |
T |
 |
Q |
228 |
atctactaaaatcttcactaaaatgtcttgtccctttgctcaaaacttcatc |
279 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
44856576 |
atctactaaaatcttcactaaaatgtcttgtccctttgctcaaaacttcatc |
44856627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University