View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0090_low_9 (Length: 231)
Name: NF0090_low_9
Description: NF0090
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0090_low_9 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 194; Significance: 1e-105; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 9 - 214
Target Start/End: Complemental strand, 47391302 - 47391097
Alignment:
| Q |
9 |
gagcagagatggaggcctccaaattaagtgcatcagagtcggtgacagcttgcttggaggtcgcaaagaaggagaaaaaatatttgaagaaacttctagc |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47391302 |
gagcagagatggaggcctccaaattaagtgcatcagagtcggtgacagcttgcttggaagtcgcaaagaaggagaaaaaatatttgaagaaacttctagc |
47391203 |
T |
|
| Q |
109 |
ttgggaaaacagaaaaagctaagctgcaaacggagatttctgatttgaaagagaagatattagaggattgagaagtgtcagctcagaataagcagcgcca |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47391202 |
ttgggaaaacagaaaaagctaagctgcaaatggagatttctgatttgaaagggaagatattagaggattgagaagtgtcagctcagaataagcagcgcca |
47391103 |
T |
|
| Q |
209 |
aaaaga |
214 |
Q |
| |
|
|||||| |
|
|
| T |
47391102 |
aaaaga |
47391097 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 9 - 214
Target Start/End: Original strand, 40624828 - 40625032
Alignment:
| Q |
9 |
gagcagagatggaggcctccaaattaagtgcatcagagtcggtgacagcttgcttggaggtcgcaaagaaggagaaaaaatatttgaagaaacttctagc |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| || ||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
40624828 |
gagcagagatggaggcctccaaattaagtgcatcagagtcagtgacagcttgcttggaagttgcaaaaaaggagaaaaaatacttgaagaaacttctagc |
40624927 |
T |
|
| Q |
109 |
ttgggaaaacagaaaaagctaagctgcaaacggagatttctgatttgaaagagaagatattagaggattgagaagtgtcagctcagaataagcagcgcca |
208 |
Q |
| |
|
||||||||| | | |||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
40624928 |
ttgggaaaa-acagaaagctaagctgcaaaaggagatttctgatttgaaagagaagatattagaggatcgagaagtgtcagctcagaataagcagcgcca |
40625026 |
T |
|
| Q |
209 |
aaaaga |
214 |
Q |
| |
|
|||||| |
|
|
| T |
40625027 |
aaaaga |
40625032 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1057 times since January 2019
Visitors: 1289