View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0091-INSERTION-8 (Length: 190)
Name: NF0091-INSERTION-8
Description: NF0091
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0091-INSERTION-8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 8 - 178
Target Start/End: Complemental strand, 56486052 - 56485876
Alignment:
Q |
8 |
tcttcttcgtccacttgttattatgtacatactcttacttcaattaactaactaattcataattcattg------atgatgatgttgtagtgtttgttgg |
101 |
Q |
|
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
T |
56486052 |
tcttcttcgtccacttgttattatatacatactcttacttcaattaactaactaattcataattcattgctgatgatgatgatgttgtagtgtttgttgg |
56485953 |
T |
 |
Q |
102 |
ttcaaattggatcgatcgttccattcattcattcatcgatcactaataatattaaaatactttgctgcattcatatt |
178 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
56485952 |
ttcaaattggatcgatcgttccattcattcattcatcgatcactaataatattaaaatactttgctgcattcatatt |
56485876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University