View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0091-INSERTION-8 (Length: 190)

Name: NF0091-INSERTION-8
Description: NF0091
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0091-INSERTION-8
NF0091-INSERTION-8
[»] chr4 (1 HSPs)
chr4 (8-178)||(56485876-56486052)


Alignment Details
Target: chr4 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 8 - 178
Target Start/End: Complemental strand, 56486052 - 56485876
Alignment:
8 tcttcttcgtccacttgttattatgtacatactcttacttcaattaactaactaattcataattcattg------atgatgatgttgtagtgtttgttgg 101  Q
    |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||      |||||||||||||||||||||||||    
56486052 tcttcttcgtccacttgttattatatacatactcttacttcaattaactaactaattcataattcattgctgatgatgatgatgttgtagtgtttgttgg 56485953  T
102 ttcaaattggatcgatcgttccattcattcattcatcgatcactaataatattaaaatactttgctgcattcatatt 178  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
56485952 ttcaaattggatcgatcgttccattcattcattcatcgatcactaataatattaaaatactttgctgcattcatatt 56485876  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University