View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0091_high_14 (Length: 221)
Name: NF0091_high_14
Description: NF0091
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0091_high_14 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 118; Significance: 2e-60; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 7 - 152
Target Start/End: Original strand, 38160802 - 38160947
Alignment:
| Q |
7 |
ctttgaactttgaaatatgcaggattcacaaggagcaggtcgaaaagtggcaggaagaaatcaaagaattgcgtgcacttgatgcctcaaatgaggaagc |
106 |
Q |
| |
|
|||| |||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
38160802 |
cttttaactttccaatatgcaggattcacaaggagcaggtcgaaaaatggcaggaagaaatcaaagaactgcgtgcacttgatgcctcaaatgaggaagc |
38160901 |
T |
|
| Q |
107 |
caatgctcttctgcaaaatgctcgatacgtacttcatctcactcga |
152 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||| ||||||||| |
|
|
| T |
38160902 |
caatgctcttctgcaaaatgctcgatatgtacttcagctcactcga |
38160947 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 7 - 151
Target Start/End: Original strand, 38116976 - 38117120
Alignment:
| Q |
7 |
ctttgaactttgaaatatgcaggattcacaaggagcaggtcgaaaagtggcaggaagaaatcaaagaattgcgtgcacttgatgcctcaaatgaggaagc |
106 |
Q |
| |
|
|||| |||||| ||||| |||||||||||||||||||||| ||||| ||||||||||||||||||||| | |||||||| |||||||||||||||||||| |
|
|
| T |
38116976 |
cttttaactttcaaataagcaggattcacaaggagcaggttgaaaaatggcaggaagaaatcaaagaactccgtgcactcgatgcctcaaatgaggaagc |
38117075 |
T |
|
| Q |
107 |
caatgctcttctgcaaaatgctcgatacgtacttcatctcactcg |
151 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||| |||||||| |
|
|
| T |
38117076 |
caatgctcttctgcaaaatgctcgatatgtacttcagctcactcg |
38117120 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 101; Significance: 3e-50; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 7 - 151
Target Start/End: Original strand, 49004779 - 49004923
Alignment:
| Q |
7 |
ctttgaactttgaaatatgcaggattcacaaggagcaggtcgaaaagtggcaggaagaaatcaaagaattgcgtgcacttgatgcctcaaatgaggaagc |
106 |
Q |
| |
|
|||| |||||| ||||| |||||||||||||||||||||| ||||| ||||||||||||||||||||| | || ||||| |||||||||||||||||||| |
|
|
| T |
49004779 |
cttttaactttcaaataagcaggattcacaaggagcaggttgaaaaatggcaggaagaaatcaaagaactccgagcactcgatgcctcaaatgaggaagc |
49004878 |
T |
|
| Q |
107 |
caatgctcttctgcaaaatgctcgatacgtacttcatctcactcg |
151 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||| |||||||| |
|
|
| T |
49004879 |
caatgctcttctgcaaaatgctcgatatgtacttcagctcactcg |
49004923 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1563 times since January 2019
Visitors: 1302